Aberrant expression of KDM1A inhibits ferroptosis of lung cancer cells through upregulation of c-Myc

Data collection

UALCAN (http://ualcan.ruta.uab.edu/) and TNMplot (https://tnmplot.com/analysis/), two comprehensive and user-friendly databases were used to analyze KDM1A mRNA and protein levels in cancers16,17. Two survival databases, PrognoScan18 and Kaplan-Meier tracer19, were used to analyze the effect of KDM1A expression on patient prognosis, including relapse-free survival (RFS), overall survival (OS), and first progression (FP). KDM1A expression levels in lung cancer tissues were further analyzed using two Gene Expression Omnibus (GEO) data sets, GSE13213 and GSE31210. The database, cBioPortal, was used to analyze KDM1A co-expressed genes in a lung adenocarcinoma dataset (TCGA, PanCancer Atlas). And GSEA pathway analysis was performed using Xiantao Xueshu (https://www.xiantao.love/products).

Cell culture and reagents.

Human lung cancer cell lines H1299, A549, H157 and H358 were obtained from Cancer Research Institute, Central South University, China. Cells were grown in a 37°C incubator with 5% COtwo. Cell culture medium for A549 was RPMI-1640 (Procell, Cat#PM150110P) with 10% FBS (Gbico, Cat#10099141C). And cell culture media for H1299, H157 and H358 were Dulbecco’s Modified Eagle’s Medium (DMEM) (Procell, Cat#PM150210P) with 10% FBS. H1299-shKDM1A and A549-shKDM1A cells were cultured with the respective medium supplemented with 1 µg/ml puromycin (Beyotime, Cat#ST551). Exposure concentrations of erastin (Sigma-Aldrich, Cat#E7781) and ferrostatin-1 (APExBIO, Cat#A4371) in lung cancer cells were 5 μM and 10 μM, respectively.

Production and infection of lentiviruses

293 T cells were plated in 6 mm dishes and co-transfected with Pax2 and VSVG lentivirus package plasmid the next day. After 48 h of incubation at 37 °C, we collected virus-containing supernatants. For cell infection, the mixture of liquid virus and polybrene (5 µg/ml) was added to the cell culture medium. Sequences for the KDM1A shRNAs (shKDM1As) were obtained as previously described.twenty and inserted into the lentiviral vectors pLKO.1. shKDM1A: GATCCCCAGGAAGGCTCT TCTAGCAATATTCAAGAGATATTGCTAGAAGAGCCTTCCTTTTTTC, TCGAGA AAAAAGGAAGGCTCTTCTAGCAATATCTCTTGAATATTGCTAGAAGAGCCTTCCTGGG; shKDM1A-2: GATCCCCGGAGCTCCTGATTTGACAAAGTTCAAGA GACTTTGTCAAATCAGGAGCTCCTTTTTC, TCGAGAAAAAAGGAGCTCCTGA TTTGACAAAGTCTCTTGAACTTTGTCAAATCAGGAGCTCCGGG; shCtrl:GATCCCCAATTGCCACAACAGGGTCGTGTTCAAGAGA, CACGACCCTGCCGTGGCAATTTTTTTC, TCGAGAAAAAAAATTGCCA, CAACAGGGTCGTGTCTCTTGAACACGACCCTGCCGTGGCAATTGGG.

transient transfection

We purchased c-Myc siRNA from Genepharma (China) based on the above reporttwenty-one. We performed siRNA transfection into cancer cells according to the manufacturer’s introductions of lipofectamine 3000 (Invitrogen, USA). In short, 1 × 106 cells were seeded in 60 mm dishes and transfection was performed the next day. After 48 h of incubation, cells were harvested for further experiments.

RNA isolation and real-time polymerase chain reaction

After extraction using Trizol (Invitrogen, Cat. No. 15596018), total RNA was reverse transcribed with the reverse transcription kit, PrimeScript First-Strand cDNA Synthesis Kit (Takara, Cat. No. 6210A). . Next, we used real-time polymerase chain reaction (RT-PCR) to analyze the transcriptional levels of KDM1A, c-Myc, and HMOX1. The sequences of the forward and reverse primers are as follows: β-actin: 5′-CATGTACGTTGCTATCCAGGC-3′ and 5′-CTCCTTAATGTCACGCACGAT-3′; KDM1A: 5′-TGACCGGATGACTTCTCAAGA-3′ and 5′-GTTGGAGAGTAGCCTC AAATGTC-3′; c-Myc: 5′-GGCTCCTGGCAAAAGGTCA-3′ and 5′-CTGCGTAGTT GTGCTGATGT-3′. HMOX1: 5′-AAGACTGCGTTCCTGCTCAAC-3′ and 5′-AAAGCCCTACAGCAACTGTCG-3′. We use both−∆∆CT method to calculate their relative expression levels.

western spot

After extraction with lysis buffer (Thermo Scientific, USA), the total protein was resolved on SDS-PAGE and transferred to nitrocellulose membrane (Millipore, USA). The nitrocellulose membrane was then blocked in 5% skim milk and incubated with the indicated primary antibodies at 4°C overnight. The following antibodies were used: anti-KDM1A (Abcam, United States, Cat#ab17721), anti-c-Myc (Santa Cruz, United States, Cat# sc-40), anti-HMOX1 (Proteintech, United States, Cat# 10701-1-AP) and anti-β-actin (Santa Cruz, United States, Cat# sc-69879). Protein levels were determined using chemiluminescence reagent (Millipore, USA). According to molecular weight, the nitrocellulose membrane was cut prior to antibody hybridization and visualized using the ChemiDoc XRS system (Bio-Rad, Berkeley).

Cell viability assay

We performed the cell proliferation assay according to the manufacturer’s introductions of the MTS assay kit (B34304, Bimake, USA). In short, 1 × 103 cells were seeded in a 96-well plate. After incubation with erastin (5 μM) or RSL3 (1 μM), ferrostatin-1 (10 μM) for 72 h and MTS solution for 1 h, the optical density of cells at 450 nm was detected with a spectrometer (PerkinElmer, USA) .

Iron level assay

We detected the concentration of cellular irons according to the manufacturer’s introductions of the iron assay kit (Abcam, USA). After treatment with the ferroptosis inducer erastin (5 μM) or RSL3 (1 μM) for 24 h, cells were rapidly mixed with iron assay buffer. We then removed insoluble material and added the iron assay buffer and iron probe to the reaction mixture. Finally, the spectrometric absorbance at the wavelength of 593 nm was detected.

MDA level assay

We detected cellular malondialdehyde (MDA) concentration according to the manufacturer’s introductions of the lipid peroxidation assay kit (Sigma-Alorich, USA). After treatment with the ferroptosis inducer erastin (5 μM) or RSL3 (1 μM) for 24 h, cells were lysed on ice by ultrasound. We then removed insoluble material and added thiobarbituric acid (TBA) solution to the samples. Finally, the spectrometric absorbance at the wavelength of 532 nm was detected.

statistic analysis

All data plotted were shown as mean ± standard deviation (SD). Student’s t-test and one-way analysis of variance (ANOVA) were used for comparisons of differences or multivariate analysis. The difference is statistically significant (*p < 0.05, **p < 0.01 and ***p < 0.001).

Leave a Comment